Quimigen Portugal > Caveolin 3 (CAV3) (NM_001234) Human Untagged Clone
Caveolin 3 (CAV3) (NM_001234) Human Untagged Clone
Referência SC302995
Tamanho : 10ug
Contactar o distribuidor local :
Telefone :
Caveolin 3 (CAV3) (NM_001234) Human Untagged Clone
Be the first to review this product
SKU
SC302995
CAV3 (untagged)-Human caveolin 3 (CAV3), transcript variant 2
Other products for "Caveolin 3 or NM_001234"
| Product Data | |
| Type | Human Untagged Clone |
|---|---|
| Target Symbol | Caveolin 3 |
| Synonyms | LGMD1C; LQT9; MPDT; RMD2; VIP-21; VIP21 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data | >OriGene sequence for NM_001234 edited GATGATGGCAGAAGAGCACACAGATCTCGAGGCCCAGATCGTCAAGGATATCCACTGCAA GGAGATTGACCTGGTGAACCGAGACCCCAAGAACATTAACGAGGACATAGTCAAGGTGGA TTTTGAAGACGTGATCGCAGAGCCTGTGGGCACCTACAGCTTTGACGGCGTGTGGAAGGT GAGCTACACCACCTTCACTGTCTCCAAGTACTGGTGCTACCGTCTGTTGTCCACGCTGCT GGGCGTCCCACTGGCCCTGCTCTGGGGCTTCCTGTTCGCCTGCATCTCCTTCTGCCACAT CTGGGCGGTGGTGCCATGCATTAAGAGCTACCTGATCGAGATCCAGTGCATCAGCCACAT CTACTCACTCTGCATCCGCACCTTCTGCAACCCACTCTTCGCGGCCCTGGGCCAGGTCTG CAGCAGCATCAAGGTGGTGCTGCGGAAGGAGGTCTAAAGCCAGGTGGGGCAACAGCGGTG GCAGGGCAGGGGGTGGTGGGCCAGACTGGTCCCCGGGGGACTTCTTCACAGGGGCTGCTG GCGAGCTCTTTCTCTTTAGGGACTGCTCCATACCCCATGATGGAGCACACGGTGTAGGGA AGCCAGAAAGAAAAGACGGCCCAGCC |
| Restriction Sites | Please inquire | |
| ACCN | NM_001234 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_001234.3, NP_001225.1 |
| RefSeq Size | 1329 bp |
| RefSeq ORF | 456 bp |
| Locus ID | 859 |
| UniProt ID | P56539 |
| Cytogenetics | 3p25.3 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Focal adhesion |
| Summary | This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. provided by RefSeq, Jul 2008 Transcript Variant: This variant (2) is shorter than variant 1, since it lacks a differentially spliced intron located in the 3' UTR, but both transcripts encode identical proteins. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
| Product Manuals |
| FAQs |
|
| SDS |
| SKU | Description | Size | ||
|---|---|---|---|---|
| RC210118 | CAV3 (Myc-DDK-tagged)-Human caveolin 3 (CAV3), transcript variant 2 | 10 ug | | |
| RC210118L1 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, Myc-DDK-tagged | 10 ug | | |
| RC210118L2 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, mGFP tagged | 10 ug | | |
| RC210118L3 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, Myc-DDK-tagged | 10 ug | | |
| RC210118L4 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, mGFP tagged | 10 ug | | |
| RG210118 | CAV3 (tGFP-tagged) - Human caveolin 3 (CAV3), transcript variant 2 | 10 ug | | |
Citations
Cell surface expression of human ether-a-go-go-related gene (hERG) channels is regulated by caveolin-3 protein via the ubiquitin ligase Nedd4-2
Guo, Wang, Li et al
J. Biol. Chem. (2012) 287 (40), 33132-41 DOI: 10.1074/jbc.M112.389643
Guo, Wang, Li et al
J. Biol. Chem. (2012) 287 (40), 33132-41 DOI: 10.1074/jbc.M112.389643
Cited by 7
AI Summary: OriGene products contributed to this study by providing the Cav3 plasmid and Myc-tagged Nedd4-1 plasmid, which were used to investigate the molecular interactions regulating hERG channel expression.
Snippet: delays cardiac repolarization and causes long QT syndrome (3). However, an increase in I hERG can cause short QT syndrome (4). Both long QT syndrome and short QT syndrome ... Cav3 plasmid and Myc-tagged plasmid of Nedd4-1 were obtained from Origene Technologies.
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Related Products
Você também pode estar interessado nos seguintes produtos:
Referência
Descrição
Cond.
Price Bef. VAT