Caveolin 3 (CAV3) (NM_001234) Human Untagged Clone

Cat# SC302995

Size : 10ug

Contact local distributor :


Phone :

Caveolin 3 (CAV3) (NM_001234) Human Untagged Clone

Be the first to review this product
SKU
SC302995
CAV3 (untagged)-Human caveolin 3 (CAV3), transcript variant 2
 
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Caveolin 3
Synonyms LGMD1C; LQT9; MPDT; RMD2; VIP-21; VIP21
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001234 edited
GATGATGGCAGAAGAGCACACAGATCTCGAGGCCCAGATCGTCAAGGATATCCACTGCAA
GGAGATTGACCTGGTGAACCGAGACCCCAAGAACATTAACGAGGACATAGTCAAGGTGGA
TTTTGAAGACGTGATCGCAGAGCCTGTGGGCACCTACAGCTTTGACGGCGTGTGGAAGGT
GAGCTACACCACCTTCACTGTCTCCAAGTACTGGTGCTACCGTCTGTTGTCCACGCTGCT
GGGCGTCCCACTGGCCCTGCTCTGGGGCTTCCTGTTCGCCTGCATCTCCTTCTGCCACAT
CTGGGCGGTGGTGCCATGCATTAAGAGCTACCTGATCGAGATCCAGTGCATCAGCCACAT
CTACTCACTCTGCATCCGCACCTTCTGCAACCCACTCTTCGCGGCCCTGGGCCAGGTCTG
CAGCAGCATCAAGGTGGTGCTGCGGAAGGAGGTCTAAAGCCAGGTGGGGCAACAGCGGTG
GCAGGGCAGGGGGTGGTGGGCCAGACTGGTCCCCGGGGGACTTCTTCACAGGGGCTGCTG
GCGAGCTCTTTCTCTTTAGGGACTGCTCCATACCCCATGATGGAGCACACGGTGTAGGGA
AGCCAGAAAGAAAAGACGGCCCAGCC
Restriction Sites Please inquire |
ACCN NM_001234
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001234.3, NP_001225.1
RefSeq Size 1329 bp
RefSeq ORF 456 bp
Locus ID 859
UniProt ID P56539
Cytogenetics 3p25.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Focal adhesion
Summary This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) is shorter than variant 1, since it lacks a differentially spliced intron located in the 3' UTR, but both transcripts encode identical proteins. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
SKU Description Size
RC210118 CAV3 (Myc-DDK-tagged)-Human caveolin 3 (CAV3), transcript variant 2 10 ug
RC210118L1 Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, Myc-DDK-tagged 10 ug
RC210118L2 Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, mGFP tagged 10 ug
RC210118L3 Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, Myc-DDK-tagged 10 ug
RC210118L4 Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, mGFP tagged 10 ug
RG210118 CAV3 (tGFP-tagged) - Human caveolin 3 (CAV3), transcript variant 2 10 ug

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

You might also be interested by the following products:



Cat#
Description
Cond.
Price Bef. VAT