ANGPTL6 (NM_031917) Human 3' UTR Clone

Referência SC203104

Tamanho : 10ug

Contactar o distribuidor local :


Telefone :

ANGPTL6 (NM_031917) Human 3' UTR Clone

Be the first to review this product
SKU
SC203104
3' UTR clone of angiopoietin-like 6 (ANGPTL6) for miRNA target validation
 
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ANGPTL6
Synonyms AGF; ARP5
ACCN NM_031917
Insert Size 281 bp
Sequence Data
Insert Sequence
>SC203104 3’UTR clone of NM_031917
The sequence shown below is from the reference sequence of NM_031917. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCATGCTCATTCGGCCCCTGAAGCTGTGACTCTGTGTTCCTCTGTCCCCTAGGCCCTAGAGGACATTG
GTCAGCAGGAGCCCAAGTTGTTCTGGCCACACCTTCTTTGTGGCTCAGTGCCAATGTGTCCCACAGAAC
TTCCCACTGTGGATCTGTGACCCTGGGCGCTGAAAATGGGACCCAGGAATCCCCCCCGTCAATATCTTG
GCCTCAGATGGCTCCCCAAGGTCATTCATATCTCGGTTTGAGCTCATATCTTATAATAACACAAAGTAG
CCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031917.3
Locus ID 83854
MW 10.4
Summary May play a role in the wound healing process. May promote epidermal proliferation, remodeling and regeneration. May promote the chemotactic activity of endothelial cells and induce neovascularization. May counteract high-fat diet-induced obesity and related insulin resistance through increased energy expenditure.UniProtKB/Swiss-Prot Function

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.