Prima1 Mouse qPCR Primer Pair (NM_133364)

Cat# MP211767

Size : 200reactions

Contact local distributor :


Phone :

Prima1 Mouse qPCR Primer Pair (NM_133364)

Be the first to review this product
SKU
MP211767
qSTAR qPCR primer pairs against Mus musculus gene Prima1
 
Specifications
Product Data
Locus ID 170952
Forward Sequence GGTCTGGTGATCATTGTCGCTG
Reverse Sequence TCAGCGACACTGGTGCCATTCT
ACCN NM_133364, NM_133364.1, NM_133364.2, BC134395, BC145454, BC160332, BC171927, BC171928, BC171929
UniProt ID Q810F0
Synonyms B230212M13Rik; BB120497; PRiMA
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.