Quimigen Portugal > HLA-DRA (NM_019111) Human Untagged Clone
HLA-DRA (NM_019111) Human Untagged Clone
Cat# SC322003
Size : 10ug
HLA-DRA (NM_019111) Human Untagged Clone
Be the first to review this product
SKU
SC322003
HLA (untagged)-Human major histocompatibility complex, class II, DR alpha (HLA-DRA)
calcActive())">
| Product Data | |
| Type | Human Untagged Clone |
|---|---|
| Target Symbol | HLA-DRA |
| Synonyms | HLA-DRA1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | >OriGene sequence for SC322003 CCTCACTCCCGAGCTCTACTGACTCCCAAAAGAGCGCCCAAGAAGAAAATGGCCATAAGT GGAGTCCCTGTGCTAGGATTTTTCATCATAGCTGTGCTGATGAGCGCTCAGGAATCATGG GCTATCAAAGAAGAACATGTGATCATCCAGGCCGAGTTCTATCTGAATCCTGACCAATCA GGCGAGTTTATGTTTGACTTTGATGGTGATGAGATTTTCCATGTGGATATGGCAAAGAAG GAGACGGTCTGGCGGCTTGAAGAATTTGGACGATTTGCCAGCTTTGAGGCTCAAGGTGCA TTGGCCAACATAGCTGTGGACAAAGCCAACCTGGAAATCATGACAAAGCGCTCCAACTAT ACTCCGATCACCAATGTACCTCCAGAGGTAACTGTGCTCACGAACAGCCCTGTGGAACTG AGAGAGCCCAACGTCCTCATCTGTTTCATCGACAAGTTCACCCCACCAGTGGTCAATGTC ACGTGGCTTCGAAATGGAAAACCTGTCACCACAGGAGTGTCAGAGACAGTCTTCCTGCCC AGGGAAGACCACCTTTTCCGCAAGTTCCACTATCTCCCCTTCCTGCCCTCAACTGAGGAC GTTTACGACTGCAGGGTGGAGCACTGGGGCTTGGATGAGCCTCTTCTCAAGCACTGGGAG TTTGATGCTCCAAGCCCTCTCCCAGAGACTACAGAGAACGTGGTGTGTGCCCTGGGCCTG ACTGTGGGTCTGGTGGGCATCATTATTGGGACCATCTTCATCATCAAGGGAGTGCGCAAA AGCAATGCAGCAGAACGCAGGGGGCCTCTGTAAGGCACATGGAGGTGATGGTGTTTCTTA GAGAGAAGATCACTGAAGAAACTTCTGCTTTAATGACTTTACAAAGCTGGCAATATTACA ATCCTTGACCTCAGTGAAAGCAGTCATCTTCAGCGTTTTCCAGCCCTATAGCCACCCCAA GTGTGGTTATGCCTCCTCGATTGCTCCGTACTCTAACATCTAGCTGGCTTCCCTGTCTAT TGCCTTTTCCTGTATCTATTTTCCTCTATTTCCTATCATTTTATTATCACCATGCAATGC CTCTGGAATAAAACATACAGGAGTCTGTCTCTGCTATGGAATGCCCCATGGGGCATCTCT TGTGTACTTATTGTTTAAGGTTTCCTCAAACTGTGATTTTTCTGAACACAATAAACTATT TTGATGATCTTGGGTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire | |
| ACCN | NM_019111 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_019111.3, NP_061984.2 |
| RefSeq Size | 1267 bp |
| RefSeq ORF | 765 bp |
| Locus ID | 3122 |
| UniProt ID | P01903 |
| Cytogenetics | 6p21.32 |
| Domains | ig, IGc1, MHC_II_alpha |
| Protein Families | Transmembrane |
| Protein Pathways | Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Hematopoietic cell lineage, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis |
| Summary | HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. This molecule is expressed on the surface of various antigen presenting cells such as B lymphocytes, dendritic cells, and monocytes/macrophages, and plays a central role in the immune system and response by presenting peptides derived from extracellular proteins, in particular, pathogen-derived peptides to T cells. The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. provided by RefSeq, Aug 2020 |
| Product Manuals |
| FAQs |
|
| SDS |
| SKU | Description | Size | ||
|---|---|---|---|---|
| RC209920 | HLA (Myc-DDK-tagged)-Human major histocompatibility complex, class II, DR alpha (HLA-DRA) | 10 ug | | |
| RC209920L1 | Lenti ORF clone of Human major histocompatibility complex, class II, DR alpha (HLA-DRA), Myc-DDK-tagged | 10 ug | | |
| RC209920L2 | Lenti ORF clone of Human major histocompatibility complex, class II, DR alpha (HLA-DRA), mGFP tagged | 10 ug | | |
| RC209920L3 | Lenti ORF clone of Human major histocompatibility complex, class II, DR alpha (HLA-DRA), Myc-DDK-tagged | 10 ug | | |
| RC209920L4 | Lenti ORF clone of Human major histocompatibility complex, class II, DR alpha (HLA-DRA), mGFP tagged | 10 ug | | |
| RG209920 | HLA (tGFP-tagged) - Human major histocompatibility complex, class II, DR alpha (HLA-DRA) | 10 ug | | |
| SC113252 | HLA (untagged)-Human major histocompatibility complex, class II, DR alpha (HLA-DRA) | 10 ug | | |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

