EPHA8 (NM_001006943) Human 3' UTR Clone

Cat# SC203134

Size : 10ug

Contact local distributor :


Phone :

EPHA8 (NM_001006943) Human 3' UTR Clone

Be the first to review this product
SKU
SC203134
3' UTR clone of EPH receptor A8 (EPHA8) transcript variant 2 for miRNA target validation
 
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol EPHA8
Synonyms EEK; EK3; HEK3
ACCN NM_001006943
Insert Size 272 bp
Sequence Data
Insert Sequence
>SC203134 3’UTR clone of NM_001006943
The sequence shown below is from the reference sequence of NM_001006943. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGAGCTGGAGGCTCTTCATTGCCTTTAGAAAAGTGGAACACATTCTATAAGTAAGAGAAATCCCAAA
AGCTCAGAGGCAGGCTAGTGTGGCCGTCGAAAGCCTAGGTTCCAGAACTTTCCCTCTCTGTGCCTCAGT
TTCCTCCCTGGTGCAATGGGAATAATAGTACCTGCCTGAGGTCCTCTCAGGAGGCTTAAATGAGAGGAA
TGAAATTGCTTAGCCCAGCACCTGGCCCGTGGTAAATGCTCAATAAATGTCATTAAAAAATAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001006943.3
Locus ID 2046
MW 9.8
Summary This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. provided by RefSeq, Jul 2008

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.