Human Thyroid Peroxidase (TPO) activation kit by CRISPRa
Referência GA104957
Tamanho : 1kit
Contactar o distribuidor local :
Human Thyroid Peroxidase (TPO) activation kit by CRISPRa
2 Weeks*
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
|---|---|
| Target Symbol | TPO |
| Locus ID | 7173 |
| Components | GA104957G1, Thyroid Peroxidase gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTGGCGTCCGTTCTTCGT GA104957G2, Thyroid Peroxidase gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCACATGCAGTCCAGCCTC GA104957G3, Thyroid Peroxidase gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCATGTGGACCCCGATGACA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_000547, NM_001206744, NM_001206745, NM_175719, NM_175720, NM_175721, NM_175722 |
| UniProt ID | P07202 |
| Synonyms | MSA; TDH2A; TPX |
| Summary | This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011] |
| Product Manuals |
| FAQs |
|
| SDS |
| SKU | Description | Size | ||
|---|---|---|---|---|
| KN410659 | TPO - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit | | |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.